IS THE SPIKE PROTEIN BINDING METALS IN OUR CELLS? IS THE SPIKE “CHELATING” THE BODY OF ESSENTIAL BIOMETALS? IS THIS WHY PRION DISEASE IS RAPIDLY PROLIFERATING?
IS THE SPIKE PROTEIN BINDING METALS IN OUR CELLS? IS THE SPIKE “CHELATING” THE BODY OF ESSENTIAL BIOMETALS? IS THIS WHY PRION DISEASE IS RAPIDLY PROLIFERATING?
I believe that, apart from the deleterious effects the Spike Protein has on the Endothelium, it is having another extremely sinister effect on the body.
Walter - I am looking at a reverse photosynthesis hypothesis, with the mitochondria taking the place of the sun, and the spike the “plant” - this would fit!
It struck me early on - that everything in life right now was being inverted - like the 4 ministries of Orwell’s 1984: The Ministry of Truth, the Ministry of Peace, the Ministry of Love, and the Ministry of Plenty!
Well to that List you can add a 5th ministry - the Ministry of Energy!
Indeed, Photosynthesis can be viewed as an inversion of cellular respiration.
The overall equation is for photosynthesis is -
6CO2 + 6H2O + light energy ➡️ C6H12O6 + 6O2
And cellular respiration -
C6H12O6 + 6O2 ➡️ 6H20 + 6CO2 + energy ATP
The first stage of is glycolysis -.which is greatly increased in Covid.
Although we do not possess a ferredoxin/thioredoxin system as such, we do have Ferredoxin-1 which participates in the synthesis of thyroid hormones and transfers electrons from adrenodoxin reductase to a CYP450 enzyme responsible for cholesterol side chain cleavage, which has the capability to bind to metals and proteins.
We also have Ferredoxin-2 which participates in heme A and iron–sulphur protein synthesis.
Moreover, ACE2 has been found to have a Ferredoxin-like fold which could facilitate a transfer of energy/electrons to the spike protein.
This enzyme is essential for cell growth and survival and most importantly - defence against oxidative stress. Quite important in Covid.
For example, In brown adipose tissue TRX2 deficiency activates mtDNA-NLRP3 to impair thermogenesis and protect against diet-induced insulin resistance.
TRX2 ablation has been shown to improve systematic metabolic performance via enhancing lipid uptake, which protects mice from diet-induced obesity, hypertriglyceridemia, and insulin resistance.
Mechanistically, the loss of TRX2 induces excessive mitochondrial ROS, mitochondrial integrity disruption, and cytosolic release of mitochondrial DNA, which in turn activates an innate immune response in BAT, including the cGAS/STING and the NLRP3 inflammasome pathways - sounds familiar!
Now ask, why have we evolved with Blue light receptors in our retina, blood vessels and fat cells?
Plants have also evolved with their own version of flavoproteins - called flavonoids!
The UVB induced production of ROS in plants leads to the biosynthesis of flavonoids which essentially functions as a sunscreen!
The Latin word flavus, means yellow, their color in nature - yellow is the complementary colour of blue - which means it absorbs blue light - blue light is greatest when the sun is directly overhead - midday at the equator.
It is also the frequency of light emitted from the screens of modern technology and light bulbs!
So, flavonoids not only protect the plant from UV light they also enable them to harness the energy from blue light!
This light absorption is why flavonoids have anti-oxidant properties and can be beneficial in Covid!
Examples of flavonoids in nature include: Quercetin, green tea, red wine, dark chocolate, citrus fruits.
Indeed, all the proposed therapeutics that actually work to some degree in Covid are very good at absorbing UV light!
This would give CGG ➡️ TGG or Arginine - Tryptophan!
Presumably this would then allow the UVB energy to be absorbed by the indole ring of Tryptophan
Such a point mutation has an immunomodulating effect ARG1 - IDO-1 and I believe this is a factor in the dysregulation of the immune system by the spike protein.
A BLAST Gave a close match for both, Prochlorococcus marinus MT9313 and Gloeobacter morelensis but, when you added an additional bacteriophage - cyanophage S-RIM32 the match was even closer.
Why did I do this?
Because Cyanophages have played an integral part in the evolution and diversification of Prochlorococcus genomes and direct the energy derived from photosynthesis away from carbon fixation and towards the pentose phosphate pathway to produce pentoses and the reducing power for nucleotide biosynthesis.
P.Marinus is the smallest and most abundant photosynthetic organism on Earth.
And, plays a major role in global carbon cycles. It holds the power to fix carbon dioxide very quickly and efficiently, in large batches with very few requirements.
Indeed, seeding the ocean with iron and producing massive blooms of cyanobacteria and increasing the uptake of carbon by the oceans has been proposed as a solution to reduce CO2 and global warming - I suspect a similar process is happening with Covid!
Except, as oceanographer John Martin declared: "Give me half a tanker of iron and I'll give you an Ice Age"
Both Prochlorococcus marinus MT9313 and Gloeobacter morelensis carry out oxygenic photosynthesis ie they produce oxygen.
They also have something else, quite unique, in common - they belong to the Fdx flavin-thioredoxin reductase (FFTR) family, originally described in the nitrogen-fixating anaerobic bacterium Clostridium pasteurianum.
FFTR is thought to represent an unidentified link between anaerobic fermentation and photosynthesis.
Such Anaerobic fermentation occurs once the oxygen is discharged and replaced with N2, CO2, and is a method used by cells to extract energy from carbohydrates when oxygen or other electron acceptors are not available in the surrounding environment.
Anaerobic fermentation relies on enzymes to add a phosphate group to an individual adenosine diphosphate (ADP) molecule to produce ATP, which means it is a form of substrate-level phosphorylation.
An example would be when muscle cells need energy during times of exercise induced stress and hypoxia
Substrate-level phosphorylation occurs in the cytoplasm of cells during glycolysis or in the mitochondria during the krebs cycle.
And it is believed to be an important energy source in certain cancers
There are similarities between photophosphorylation and OXPHOS these include:
* a membrane associated electron transport chain
* creation of a proton gradient
* harvesting energy of the proton gradient by making ATP with the help of an ATP synthase.
Moreover, the types of kinases used in the body for phosphorylation - the Janus/tyrosine kinases - are also capable of carrying and transferring light because
tyrosine is an aromatic amino acid and can therefore absorb UV light.
It should be noted that there are 10 phosphorylated sites in the Spike protein of SARS-CoV2.
With respect to Walter’s point that: THE SPIKE PROTEIN IS BINDING THE COPPER THAT THE PRION PROTEIN “USES” TO PROMOTE IT’S NATURAL STATE OF ANTIOXIDANT DEFENSE.
May I suggest electrostatic forces/ lightning and the protective role of copper, zinc superoxide dismutase against UVB-induced injury of the human keratinocyte cell line HaCaT
Because electrostatic forces are able to mobilise the copper
“We also found an increasing copper mobilization with increasing lightning charge”
And reduce the iron and manganese.
“In the case of a lightning event with positive polarity, a mean of 0.16 mmol of Fe and 0.08 mmol of Mn may be electrochemically reduced and consequently mobilized”
Whilst the Miller-Urey experiments are not the complete answer to how life on Earth evolved they offer a good starting point, because there is a recent hypothesis that places prions and prion-like molecules at the heart of the chemical evolutionary process.
In the harsh environment that existed prior to the emergence of RNA as one of life’s building blocks, prions would have afforded protection for newly emerging RNA polymers, simply because they are compact and remarkably resistant to extreme environmental conditions, such as high temperatures and UV light.
From these prions, amyloids are thought to have “spawned” - these are much larger microscopic structures containing mostly β-sheets (and some α–helices) and are the product of the aggregation of PrPs resulting in the formation of misfolded proteins such as fibrils, scaffolds, and nanotubes.
So we have a progression of oxidative stress/electrophilic stress on amino acid/proteins ➡️prion ➡️amyloid ➡️ fibril/nanotubes
We suspect there are also prion like domains on both the spike protein and the ACE2 receptor
So a transfer of energy to the spike or the ACE2r could potentially cause fibrosis, amyloidosis and prion formation.
I made the link with photosynthesis back in March when I asked the question in a tweet: Is SARS-CoV2 acting like a cyanophage to mitochondria/CytP450 and transferring photonic excited electrons from tryptophan to the spike protein?
I should also have said to tryptophan in the spike protein!
and concluded that the production of radicals in response to oxidative stress, dysregulated redox homeostasis, reduced energy and immune functioning and caused the pathology associated with Covid.
Why did I link this with photosynthesis?
Because, in plants and bacteria the ferredoxin/thioredoxin system is a key element in the regulatory function of light in photosynthesis.
It’s a big concern for the environment and for our health - There will be circadian effects impacting upon metabolism and endocrine and nervous systems. It will have a greater impact upon those who live in a poor light/emf environment, struggle with anxiety/stress and have a poor diet - in that order!
In terms of the solar cycle, Alexander Chizhevsky observed that social conflict and wars intensify during peak solar flare periods and that major human events and behaviors closely follow the cycle of the sun - we are in that time now.
.....my own area of focus is upon how effectively organic systems can expect to continue reconciling BOTH infrared (VITAL to materiality, as Professor Gerald Pollack has REPEATEDLY confirmed, regulating as it DOES both collagen levels & telomeric conditions) and ultraviolet radiational values; MANY years ago I foresaw SIGNIFICANT increases in mutagenesis, cancers as a terrestrial-magnetic field buffer waned past a certain point - HIGHLY exacerbated by 275 years of artificial EMF exposures / ecosystemic corruption, other geoengineering consequences (INCLUDING these bioelectrically-reactive JABS like NONE before them.....Jamie, put this out Tuesday on someone's Substack Comments thread as a result of Miles Mathis' observations about ENZYMES; given their PROTEINACEOUS crystalline structures, caused me to realize that 'VIRUSES' are likely DYSREGULATED ones - with potentially-corrupting piezoelectric effects to cellular vitality.....)
Yes - pollack was right with his structured/EZ water acting as a capacitor/battery which is effectively charged by the sun via the photoelectric effect - with a UV 270 nm absorption peak for light. Plant chromophores also have a UV 280nm absorption peak. And Infra red radiation is then used to charge separate water.Unfortunately medicine is still living in the dark ages!
Great job, Walter! I think it's a very important thing - a balance of copper. If we have excessive amounts - it will increase inflammation, if we have some deficit - it will lead to neurological disorders during covid or vaccination.
Actually it might explain my case of long covid - no lung problems, but all the sort of inflammatory responses all over the body. I do take copper (year and more) ~ 1 mg/ day (+ 100-200 mg of selenium), and this amount might be "too much."
Copper deficiency: brings Alzheimer in the case of Covid and "vaccine"
Copper full dose increases risk of inflammation in cases of "vaccine" or covid. Taking it without zinc will get inflammation in lungs which is pneumonia.
Next time I'll try to have 0.5 mg of biologically active copper, or even less...
Thanks! Hard to figure out which to take and dosage, with every new study we need to tweak things.... zinc alone can be taken for three months then should add the copper blend.. we still do that now for prevention but may scrap both with this latest study and use only if ever get infected again. And yea at reduced copper dose. Will focus on getting zinc n copper in diet.. and stick with other natural products..I hear NAC and curcumin shouldn't be taken for months at a time but should give liver a break.. we gotta be careful even with natural products, especially for those who are on meds and risk potential interactions. Thanks again
I hear you with natural sources. I read somewhere that B3 increases zinc uptake 40%. So, I stick with that, I take creatine and d-alpha tocopherol and selenium mainly. If I feel I need a kick in the ass I take zinc for a couple of days. Since I started this I've been going good.
Really eh, I take a B complex, but didn't know it increased zinc uptake and by that much too! . Thanks for tip! I will look up creatine, selenium is part of Nac we take.. but sometimes feel like a druggie on these natural products;)
Very important findings. According to tox studies using human hair analysis Both copper and aluminum are found in high levels in the human body in the post industrialized age. I believe aluminum particles would have similar impacts. Bentonite clay binds to the complexes in gi however the particulate circulating in the blood or found interstitial and in the tissues would require anti oxidants The presence of heavy metals can changs ion channel function in cellular membranes of the brain and peripherl nervous system. Theoretically pumping the enzymes into these spaces with proteins complexes could be responsible for modulating the extraordinary increase and bloom of parkinsonian spectrum diseases unfolding over the last year. Alpha Lipoic Acid and N-Acetyl Cystine to detox. What free radical and elemental metal detox protocols would typically work?
I found a product called Sweetamine (no affiliation) that can be used as a sweetner and has 8 grams of glycine. I also use NAC and ALA. My inflammation has decreased significantly since doing so.
.....the FDA declaring FIERCE war on NAC (and by extension, glutathione) not long before this plandemic, presents now as a PARTICULARLY sinister decision against such a backdrop.....
Omg. So I just removed my copper decorative bracelet now.
I have been suffering from horrific inflammation after my vaxxes. My memory has been declining fast.
After my second vax ......2 weeks later I was brain drunk for 2 months and it slowly faded away. I had no idea. Now I have chronic brain fog with blurred vision on and off.
Got a doctor appointment next month for cognitive testing. I have done lots of the protocols and nothing worked except nigella satvia for inflammation.
Personally I would look at the multi supplement/drug? therapy used by Klinghardt to get toxins out. My limited understanding is that need to open drainage pathways at same time so doesn’t overload organs.
There are also massage techniques that can move toxins over blood brain barrier out of brain. Dr Raymond Perrin has created a technique for this and cured MS.
This is a discussion on bio mechanics and the kinetics of compounds in injectables and the spike protein and its pathways as the compounds degrade. The situation is evolving and the people on this thread are looking for impacts and offering conceptual solutions to be discussed. This is not a forum discussing treatments but hypotheticals for the purpose of steering scientific study. Many people unfortunately are being impacted similar to what you described and this effort to draw epidemiological analysis with steering studies is useful to try to identify treatment protocols for the virus and its patented protein complexes found in wild type virus including the spike protein. The studies on impacts of spike is important to understand how or why neurosegeneration could occur and potential procedures to help reduce these impacts.
Within the atmosphere and within many drugs and foods are heavy metal particulate which can reach a tipping point where too many heavy metals within the body require detox to reduce impacts. This discussion must be taken within the context of exploration and not medical advice
The design framework of how to comment is poor and my comment is not necessarily directed at you. Relax. It’s an open general question for anyone. Plus it’s providing info.
Agree. The Lyme/cfs/spectrum community has had to navigate getting help for themselves for decades now. Just trying to let people know about things available to try and restore health. Not diagnosing or giving medical advice.
Can metals affect hair , cause loss? After I had covid last year my hair began to fall out in clumbs (approx 40% hair loss) . Doctor had no idea why ( did ask if covid , but didn't he think so) after I that began communicating in fb and in person, and found lots of people esp women, who were or had experienced the same thing after covid ( some vaxxed ,some unvaxxed). After about 6 months my hair returned but has grown in super curly ( was just wavy before).. hair stylist said it reminds her of chemo patient hair events.
Whilst the Miller-Urey experiments are not the complete answer to how life on Earth evolved they offer a good starting point, because there is a recent hypothesis that places prions and prion-like molecules at the heart of the chemical evolutionary process.
In the harsh environment that existed prior to the emergence of RNA as one of life’s building blocks, prions would have afforded protection for newly emerging RNA polymers, simply because they are compact and remarkably resistant to extreme environmental conditions, such as high temperatures and UV light.
From these prions, amyloids are thought to have “spawned” - these are much larger microscopic structures containing mostly β-sheets (and some α–helices) and are the product of the aggregation of PrPs resulting in the formation of misfolded proteins such as fibrils, scaffolds, and nanotubes.
So we have a progression of oxidative stress/electrophilic stress on amino acid/proteins ➡️prion ➡️amyloid ➡️ fibril/nanotubes
We suspect there are also prion like domains on both the spike protein and the ACE2 receptor
So a transfer of energy to the spike or the ACE2r could potentially cause fibrosis, amyloidosis and prion formation.
I made the link with photosynthesis back in March when I asked the question in a tweet: Is SARS-CoV2 acting like a cyanophage to mitochondria/CytP450 and transferring photonic excited electrons from tryptophan to the spike protein?
I should also have said to tryptophan in the spike protein!
and concluded that the production of radicals in response to oxidative stress, dysregulated redox homeostasis, reduced energy and immune functioning and caused the pathology associated with Covid.
Why did I link this with photosynthesis?
Because, in plants and bacteria the ferredoxin/thioredoxin system is a key element in the regulatory function of light in photosynthesis.
That’s interesting, I always thought that some of the effects of the injection on women’s periods sounded a lot like what can happen to people with copper IUDs, although in that case it’s an excess of copper causing the inflammation.
Dr Klinghardt has a lot of info on this and is treating it with complex combo of drugs. it would be great if you get in touch with each other to brainstorm and start tackling the fall out from this.
From my 1960's high school science "binding metals" are done with electroplating or magnets. Injection site magnetism is a real thing.. hard to believe without seeing myself; there's a link to the picture by me at a rally. Mother hunches is where my skills ends.. riddle this brainy angel. :~)
Walter - I am looking at a reverse photosynthesis hypothesis, with the mitochondria taking the place of the sun, and the spike the “plant” - this would fit!
I’ll post something later.
Please do
It struck me early on - that everything in life right now was being inverted - like the 4 ministries of Orwell’s 1984: The Ministry of Truth, the Ministry of Peace, the Ministry of Love, and the Ministry of Plenty!
Well to that List you can add a 5th ministry - the Ministry of Energy!
Indeed, Photosynthesis can be viewed as an inversion of cellular respiration.
The overall equation is for photosynthesis is -
6CO2 + 6H2O + light energy ➡️ C6H12O6 + 6O2
And cellular respiration -
C6H12O6 + 6O2 ➡️ 6H20 + 6CO2 + energy ATP
The first stage of is glycolysis -.which is greatly increased in Covid.
C6H12O6 + 2 NAD+ + 2 ADP + 2 P ➡️ 2 pyruvic acid, (CH3(C=O)COOH + 2 ATP + 2 NADH + 2 H+
There is also an alternative branch of glycolysis which is used to produce the sugars that make up DNA and RNA.
This pathway is called the Pentose Phosphate Pathway. - Which is also dysregulated in covid.
https://www.biorxiv.org/content/10.1101/2020.08.19.257022v1.full.pdf
Walter alluded to the link with photosynthesis and weeds - which is a very good analogy.
Weeds are especially good at using energy and growing.
https://wmcresearch.substack.com/p/the-spike-protein-as-human-systemic
Although we do not possess a ferredoxin/thioredoxin system as such, we do have Ferredoxin-1 which participates in the synthesis of thyroid hormones and transfers electrons from adrenodoxin reductase to a CYP450 enzyme responsible for cholesterol side chain cleavage, which has the capability to bind to metals and proteins.
We also have Ferredoxin-2 which participates in heme A and iron–sulphur protein synthesis.
Moreover, ACE2 has been found to have a Ferredoxin-like fold which could facilitate a transfer of energy/electrons to the spike protein.
https://www.sciencedirect.com/science/article/pii/S2001037020304839
We also have Thioredoxin & Thioredoxin reductase.
Two classes of thioredoxin reductase have been identified: one class in bacteria and one in animals.
Both are flavoproteins - which means they are Involved in removing free radicals contributing to oxidative stress, photosynthesis and DNA repair.
Humans express three thioredoxin reductase isozymes: thioredoxin reductase 1 (TrxR1, cytosolic), thioredoxin reductase 2 (TrxR2, mitochondrial), thioredoxin reductase 3 (TrxR3, testis specific)
This enzyme is essential for cell growth and survival and most importantly - defence against oxidative stress. Quite important in Covid.
For example, In brown adipose tissue TRX2 deficiency activates mtDNA-NLRP3 to impair thermogenesis and protect against diet-induced insulin resistance.
TRX2 ablation has been shown to improve systematic metabolic performance via enhancing lipid uptake, which protects mice from diet-induced obesity, hypertriglyceridemia, and insulin resistance.
Mechanistically, the loss of TRX2 induces excessive mitochondrial ROS, mitochondrial integrity disruption, and cytosolic release of mitochondrial DNA, which in turn activates an innate immune response in BAT, including the cGAS/STING and the NLRP3 inflammasome pathways - sounds familiar!
https://www.jci.org/articles/view/148852
NB this is in mice who are Nocturnal and have scotopic vision.
In normal white fat adipose tissue however, the NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance.
https://journals.physiology.org/doi/full/10.1152/ajpcell.00379.2020
https://pubmed.ncbi.nlm.nih.gov/21217695/
Which is another kind of inversion, because in brown fat - NLRP3 can prevent insulin resistance and in white fat it causes it.
So, what makes the difference?
Answer: Light!
The white adipose tissue contains Opsin 4 or Melanopsin which is a blue light sensor - also found in the retina and blood vessels!
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8873064/
https://www.pnas.org/doi/10.1073/pnas.1420258111
Part 2 to follow
Now ask, why have we evolved with Blue light receptors in our retina, blood vessels and fat cells?
Plants have also evolved with their own version of flavoproteins - called flavonoids!
The UVB induced production of ROS in plants leads to the biosynthesis of flavonoids which essentially functions as a sunscreen!
The Latin word flavus, means yellow, their color in nature - yellow is the complementary colour of blue - which means it absorbs blue light - blue light is greatest when the sun is directly overhead - midday at the equator.
It is also the frequency of light emitted from the screens of modern technology and light bulbs!
So, flavonoids not only protect the plant from UV light they also enable them to harness the energy from blue light!
This light absorption is why flavonoids have anti-oxidant properties and can be beneficial in Covid!
Examples of flavonoids in nature include: Quercetin, green tea, red wine, dark chocolate, citrus fruits.
Indeed, all the proposed therapeutics that actually work to some degree in Covid are very good at absorbing UV light!
https://www.frontiersin.org/articles/10.3389/fpls.2015.01162/full
Having made the connection with light and photosynthesis I then started looking at Cyanobacteria (a photosynthetic bacteria) using the nucleotide sequences suggested by arkmedic - https://arkmedic.substack.com/p/absolute-proof-the-gp-120-sequences?utm_source=substack&utm_campaign=post_embed&utm_medium=web&s=r
accaatggtactaagagg
agaagttatttgactcctggtgattcttcttcaggt
cacaaaaacaacaaaagt
and CTCCTTGGTGGGCACGTAG
With CGG CGG being the genetic sequence found at the furin cleavage site of the spike protein.
What struck me was the potential of a C ➡️ T mutation
A signature mutation of UVR!
https://pubmed.ncbi.nlm.nih.gov/25354245/
This would give CGG ➡️ TGG or Arginine - Tryptophan!
Presumably this would then allow the UVB energy to be absorbed by the indole ring of Tryptophan
Such a point mutation has an immunomodulating effect ARG1 - IDO-1 and I believe this is a factor in the dysregulation of the immune system by the spike protein.
A BLAST Gave a close match for both, Prochlorococcus marinus MT9313 and Gloeobacter morelensis but, when you added an additional bacteriophage - cyanophage S-RIM32 the match was even closer.
Why did I do this?
Because Cyanophages have played an integral part in the evolution and diversification of Prochlorococcus genomes and direct the energy derived from photosynthesis away from carbon fixation and towards the pentose phosphate pathway to produce pentoses and the reducing power for nucleotide biosynthesis.
P.Marinus is the smallest and most abundant photosynthetic organism on Earth.
And, plays a major role in global carbon cycles. It holds the power to fix carbon dioxide very quickly and efficiently, in large batches with very few requirements.
Indeed, seeding the ocean with iron and producing massive blooms of cyanobacteria and increasing the uptake of carbon by the oceans has been proposed as a solution to reduce CO2 and global warming - I suspect a similar process is happening with Covid!
Except, as oceanographer John Martin declared: "Give me half a tanker of iron and I'll give you an Ice Age"
Both Prochlorococcus marinus MT9313 and Gloeobacter morelensis carry out oxygenic photosynthesis ie they produce oxygen.
They also have something else, quite unique, in common - they belong to the Fdx flavin-thioredoxin reductase (FFTR) family, originally described in the nitrogen-fixating anaerobic bacterium Clostridium pasteurianum.
FFTR is thought to represent an unidentified link between anaerobic fermentation and photosynthesis.
Such Anaerobic fermentation occurs once the oxygen is discharged and replaced with N2, CO2, and is a method used by cells to extract energy from carbohydrates when oxygen or other electron acceptors are not available in the surrounding environment.
Anaerobic fermentation relies on enzymes to add a phosphate group to an individual adenosine diphosphate (ADP) molecule to produce ATP, which means it is a form of substrate-level phosphorylation.
An example would be when muscle cells need energy during times of exercise induced stress and hypoxia
Substrate-level phosphorylation occurs in the cytoplasm of cells during glycolysis or in the mitochondria during the krebs cycle.
And it is believed to be an important energy source in certain cancers
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6311572/
This direct transfer of a phosphate group from a substrate to ADP for the formation of high energy ATP is mostly catalyzed by the enzyme kinases.
In photosynthesis this process is carried out by Photophosporylation
https://en.wikipedia.org/wiki/Photophosphorylation
There are similarities between photophosphorylation and OXPHOS these include:
* a membrane associated electron transport chain
* creation of a proton gradient
* harvesting energy of the proton gradient by making ATP with the help of an ATP synthase.
Moreover, the types of kinases used in the body for phosphorylation - the Janus/tyrosine kinases - are also capable of carrying and transferring light because
tyrosine is an aromatic amino acid and can therefore absorb UV light.
It should be noted that there are 10 phosphorylated sites in the Spike protein of SARS-CoV2.
https://www.nature.com/articles/s41598-020-74101-0
With respect to Walter’s point that: THE SPIKE PROTEIN IS BINDING THE COPPER THAT THE PRION PROTEIN “USES” TO PROMOTE IT’S NATURAL STATE OF ANTIOXIDANT DEFENSE.
May I suggest electrostatic forces/ lightning and the protective role of copper, zinc superoxide dismutase against UVB-induced injury of the human keratinocyte cell line HaCaT
https://pubmed.ncbi.nlm.nih.gov/10692109/
Because electrostatic forces are able to mobilise the copper
“We also found an increasing copper mobilization with increasing lightning charge”
And reduce the iron and manganese.
“In the case of a lightning event with positive polarity, a mean of 0.16 mmol of Fe and 0.08 mmol of Mn may be electrochemically reduced and consequently mobilized”
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3816292/
Furthermore, Copper offers excellent protection from lightning.
And where might we find a lightning bolt - electrostatic discharge
“Kopelman found electric fields as strong as 15 million volts per meter, perhaps five times stronger than the field found in a lightning bolt”
https://www.technologyreview.com/2007/12/10/128544/lightning-bolts-within-cells/
Across the inside of the mitochondrial membrane!
“giving a field strength of about 30 million volt per metre, equal to that discharged by a bolt of lightning”
https://bionumbers.hms.harvard.edu/bionumber.aspx?id=105801&ver=6
As Above So Below!
https://www.bitchute.com/video/7ISiQ7P8GxAN/
If you have not heard of the Miller-Urey experiments and chemical evolution then this is a very good introduction video.
https://youtu.be/20cHsyGIkSU
Whilst the Miller-Urey experiments are not the complete answer to how life on Earth evolved they offer a good starting point, because there is a recent hypothesis that places prions and prion-like molecules at the heart of the chemical evolutionary process.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8467930/
In the harsh environment that existed prior to the emergence of RNA as one of life’s building blocks, prions would have afforded protection for newly emerging RNA polymers, simply because they are compact and remarkably resistant to extreme environmental conditions, such as high temperatures and UV light.
From these prions, amyloids are thought to have “spawned” - these are much larger microscopic structures containing mostly β-sheets (and some α–helices) and are the product of the aggregation of PrPs resulting in the formation of misfolded proteins such as fibrils, scaffolds, and nanotubes.
So we have a progression of oxidative stress/electrophilic stress on amino acid/proteins ➡️prion ➡️amyloid ➡️ fibril/nanotubes
We suspect there are also prion like domains on both the spike protein and the ACE2 receptor
https://pubmed.ncbi.nlm.nih.gov/35208734/
So a transfer of energy to the spike or the ACE2r could potentially cause fibrosis, amyloidosis and prion formation.
I made the link with photosynthesis back in March when I asked the question in a tweet: Is SARS-CoV2 acting like a cyanophage to mitochondria/CytP450 and transferring photonic excited electrons from tryptophan to the spike protein?
I should also have said to tryptophan in the spike protein!
https://twitter.com/teamsforlife/status/1505987200768434185?s=12
and concluded that the production of radicals in response to oxidative stress, dysregulated redox homeostasis, reduced energy and immune functioning and caused the pathology associated with Covid.
Why did I link this with photosynthesis?
Because, in plants and bacteria the ferredoxin/thioredoxin system is a key element in the regulatory function of light in photosynthesis.
https://europepmc.org/article/MED/11541978
.....WITH that in mind, how would you say that the rapid geomagnetic-field weakening at 5% loss / year could impact as much, Rob?
It’s a big concern for the environment and for our health - There will be circadian effects impacting upon metabolism and endocrine and nervous systems. It will have a greater impact upon those who live in a poor light/emf environment, struggle with anxiety/stress and have a poor diet - in that order!
In terms of the solar cycle, Alexander Chizhevsky observed that social conflict and wars intensify during peak solar flare periods and that major human events and behaviors closely follow the cycle of the sun - we are in that time now.
Solar cycle 25 began in Dec 2019!
https://www.sciencedirect.com/science/article/abs/pii/S0306987706001824
.....my own area of focus is upon how effectively organic systems can expect to continue reconciling BOTH infrared (VITAL to materiality, as Professor Gerald Pollack has REPEATEDLY confirmed, regulating as it DOES both collagen levels & telomeric conditions) and ultraviolet radiational values; MANY years ago I foresaw SIGNIFICANT increases in mutagenesis, cancers as a terrestrial-magnetic field buffer waned past a certain point - HIGHLY exacerbated by 275 years of artificial EMF exposures / ecosystemic corruption, other geoengineering consequences (INCLUDING these bioelectrically-reactive JABS like NONE before them.....Jamie, put this out Tuesday on someone's Substack Comments thread as a result of Miles Mathis' observations about ENZYMES; given their PROTEINACEOUS crystalline structures, caused me to realize that 'VIRUSES' are likely DYSREGULATED ones - with potentially-corrupting piezoelectric effects to cellular vitality.....)
Yes - pollack was right with his structured/EZ water acting as a capacitor/battery which is effectively charged by the sun via the photoelectric effect - with a UV 270 nm absorption peak for light. Plant chromophores also have a UV 280nm absorption peak. And Infra red radiation is then used to charge separate water.Unfortunately medicine is still living in the dark ages!
I’m not as pessimistic about the increased UVR providing you balance it with IR and maintain Vit D
I’d say you delivered. Thanks
Great job, Walter! I think it's a very important thing - a balance of copper. If we have excessive amounts - it will increase inflammation, if we have some deficit - it will lead to neurological disorders during covid or vaccination.
Actually it might explain my case of long covid - no lung problems, but all the sort of inflammatory responses all over the body. I do take copper (year and more) ~ 1 mg/ day (+ 100-200 mg of selenium), and this amount might be "too much."
So should we ditch copper? Or take less amount?
Take zinc alone?
Copper deficiency: brings Alzheimer in the case of Covid and "vaccine"
Copper full dose increases risk of inflammation in cases of "vaccine" or covid. Taking it without zinc will get inflammation in lungs which is pneumonia.
Next time I'll try to have 0.5 mg of biologically active copper, or even less...
Thanks! Hard to figure out which to take and dosage, with every new study we need to tweak things.... zinc alone can be taken for three months then should add the copper blend.. we still do that now for prevention but may scrap both with this latest study and use only if ever get infected again. And yea at reduced copper dose. Will focus on getting zinc n copper in diet.. and stick with other natural products..I hear NAC and curcumin shouldn't be taken for months at a time but should give liver a break.. we gotta be careful even with natural products, especially for those who are on meds and risk potential interactions. Thanks again
I hear you with natural sources. I read somewhere that B3 increases zinc uptake 40%. So, I stick with that, I take creatine and d-alpha tocopherol and selenium mainly. If I feel I need a kick in the ass I take zinc for a couple of days. Since I started this I've been going good.
Really eh, I take a B complex, but didn't know it increased zinc uptake and by that much too! . Thanks for tip! I will look up creatine, selenium is part of Nac we take.. but sometimes feel like a druggie on these natural products;)
You are welcome! Stay strong!
Excellent observations. Thanks for the analysis.
Thank you for your tireless work, Walter. Your article made me think of Doc McCairn’s recent analysis of some of the vials. He found copper.
Very important findings. According to tox studies using human hair analysis Both copper and aluminum are found in high levels in the human body in the post industrialized age. I believe aluminum particles would have similar impacts. Bentonite clay binds to the complexes in gi however the particulate circulating in the blood or found interstitial and in the tissues would require anti oxidants The presence of heavy metals can changs ion channel function in cellular membranes of the brain and peripherl nervous system. Theoretically pumping the enzymes into these spaces with proteins complexes could be responsible for modulating the extraordinary increase and bloom of parkinsonian spectrum diseases unfolding over the last year. Alpha Lipoic Acid and N-Acetyl Cystine to detox. What free radical and elemental metal detox protocols would typically work?
It helps to use glycine with NAC too.
I found a product called Sweetamine (no affiliation) that can be used as a sweetner and has 8 grams of glycine. I also use NAC and ALA. My inflammation has decreased significantly since doing so.
Thanks again for these postings Walter.
.....the FDA declaring FIERCE war on NAC (and by extension, glutathione) not long before this plandemic, presents now as a PARTICULARLY sinister decision against such a backdrop.....
At this point strong objection by FDA is a better predictor of efficacy than endorsement!
......VERY true, Pamela! Having had two instances of heavy metal poisoning myself where glutathione was a GOOD friend, COULDN'T agree MORE ;)
They just "quietly" put it back on Amazon.
I think they are hoping people don't notice what they did for 2 years.
Omg. So I just removed my copper decorative bracelet now.
I have been suffering from horrific inflammation after my vaxxes. My memory has been declining fast.
After my second vax ......2 weeks later I was brain drunk for 2 months and it slowly faded away. I had no idea. Now I have chronic brain fog with blurred vision on and off.
Got a doctor appointment next month for cognitive testing. I have done lots of the protocols and nothing worked except nigella satvia for inflammation.
Edit. I’m only 58 and fading fast.
Now what do I do?? I’m lost
Personally I would look at the multi supplement/drug? therapy used by Klinghardt to get toxins out. My limited understanding is that need to open drainage pathways at same time so doesn’t overload organs.
There are also massage techniques that can move toxins over blood brain barrier out of brain. Dr Raymond Perrin has created a technique for this and cured MS.
Good luck
Do you have specific websites/links that could provide more details? Thank you!
https://klinghardtinstitute.com is his website. He keeps a very low profile on purpose. His videos only stay up for a day and then are deleted.
Perrin technique is here: https://theperrintechnique.com/about/. I apologize ME not MS!
Oh man only a day? Wow. I will check it out (regularly). Thank you.
Genova diagnostics lab has a great first morning urine test that gives you tons of information. https://www.gdx.net/product/metabolomix+nutritional-test-urine
This is a discussion on bio mechanics and the kinetics of compounds in injectables and the spike protein and its pathways as the compounds degrade. The situation is evolving and the people on this thread are looking for impacts and offering conceptual solutions to be discussed. This is not a forum discussing treatments but hypotheticals for the purpose of steering scientific study. Many people unfortunately are being impacted similar to what you described and this effort to draw epidemiological analysis with steering studies is useful to try to identify treatment protocols for the virus and its patented protein complexes found in wild type virus including the spike protein. The studies on impacts of spike is important to understand how or why neurosegeneration could occur and potential procedures to help reduce these impacts.
Within the atmosphere and within many drugs and foods are heavy metal particulate which can reach a tipping point where too many heavy metals within the body require detox to reduce impacts. This discussion must be taken within the context of exploration and not medical advice
Duh. Omg.
Read the whole thread.
The conversation expanded.
The design framework of how to comment is poor and my comment is not necessarily directed at you. Relax. It’s an open general question for anyone. Plus it’s providing info.
Agree. The Lyme/cfs/spectrum community has had to navigate getting help for themselves for decades now. Just trying to let people know about things available to try and restore health. Not diagnosing or giving medical advice.
It turns out metal ions have an “architectural purpose” in SARSCOV2...are the metal ions being used to build bridges? https://www.news-medical.net/news/20210603/SARS-CoV-2-exploits-metal-dependent-mechanism-to-evade-immune-surveillance.aspx
Can metals affect hair , cause loss? After I had covid last year my hair began to fall out in clumbs (approx 40% hair loss) . Doctor had no idea why ( did ask if covid , but didn't he think so) after I that began communicating in fb and in person, and found lots of people esp women, who were or had experienced the same thing after covid ( some vaxxed ,some unvaxxed). After about 6 months my hair returned but has grown in super curly ( was just wavy before).. hair stylist said it reminds her of chemo patient hair events.
the word is spreading .... thank you again!!!
https://twitter.com/MarcellaMartuc1/status/1568939796696793088
I will answer this in 2 parts.
If you have not heard of the Miller-Urey experiments and chemical evolution then this is a very good introduction video.
https://youtu.be/20cHsyGIkSU
Whilst the Miller-Urey experiments are not the complete answer to how life on Earth evolved they offer a good starting point, because there is a recent hypothesis that places prions and prion-like molecules at the heart of the chemical evolutionary process.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8467930/
In the harsh environment that existed prior to the emergence of RNA as one of life’s building blocks, prions would have afforded protection for newly emerging RNA polymers, simply because they are compact and remarkably resistant to extreme environmental conditions, such as high temperatures and UV light.
From these prions, amyloids are thought to have “spawned” - these are much larger microscopic structures containing mostly β-sheets (and some α–helices) and are the product of the aggregation of PrPs resulting in the formation of misfolded proteins such as fibrils, scaffolds, and nanotubes.
So we have a progression of oxidative stress/electrophilic stress on amino acid/proteins ➡️prion ➡️amyloid ➡️ fibril/nanotubes
We suspect there are also prion like domains on both the spike protein and the ACE2 receptor
https://pubmed.ncbi.nlm.nih.gov/35208734/
So a transfer of energy to the spike or the ACE2r could potentially cause fibrosis, amyloidosis and prion formation.
I made the link with photosynthesis back in March when I asked the question in a tweet: Is SARS-CoV2 acting like a cyanophage to mitochondria/CytP450 and transferring photonic excited electrons from tryptophan to the spike protein?
I should also have said to tryptophan in the spike protein!
https://twitter.com/teamsforlife/status/1505987200768434185?s=12
and concluded that the production of radicals in response to oxidative stress, dysregulated redox homeostasis, reduced energy and immune functioning and caused the pathology associated with Covid.
Why did I link this with photosynthesis?
Because, in plants and bacteria the ferredoxin/thioredoxin system is a key element in the regulatory function of light in photosynthesis.
https://europepmc.org/article/MED/11541978
Is there no end to perfidy?
That’s interesting, I always thought that some of the effects of the injection on women’s periods sounded a lot like what can happen to people with copper IUDs, although in that case it’s an excess of copper causing the inflammation.
Interesting that Kevin 🦝 said one of the jabs had high levels of copper.
Dr Klinghardt has a lot of info on this and is treating it with complex combo of drugs. it would be great if you get in touch with each other to brainstorm and start tackling the fall out from this.
From my 1960's high school science "binding metals" are done with electroplating or magnets. Injection site magnetism is a real thing.. hard to believe without seeing myself; there's a link to the picture by me at a rally. Mother hunches is where my skills ends.. riddle this brainy angel. :~)
https://www.flickr.com/photos/pameladrew/51590474203/in/album-72157720014577278/